View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8612_low_7 (Length: 215)
Name: NF8612_low_7
Description: NF8612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8612_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 52000852 - 52000677
Alignment:
| Q |
14 |
cagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatttttgcgtggatgccttggcgaatttgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52000852 |
cagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatttttgcgtggatgccttggcgaatttgg |
52000753 |
T |
|
| Q |
114 |
gttgtgaagctgattttcccttatgtatgcttctcaaattagtagtagttttctttcagctgatttagttggtttttca |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52000752 |
gttgtgaagctgattttcccttgtgtatgcttctcaaattag---tagttttctttcagctgatttagttggtttttca |
52000677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University