View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8612_low_8 (Length: 208)
Name: NF8612_low_8
Description: NF8612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8612_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 2446421 - 2446220
Alignment:
| Q |
1 |
tcaaataaactttcttatttatgtagaatcgggtccaatgcagattagaaatcttattcccatcccaagtttgtgttccgcaattatactataacagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2446421 |
tcaaataaactttcttatttatgtagaatcgggtccaatgcagattagaaatcttattcccatcccaagtttgtgttccgcaactatactataacagaat |
2446322 |
T |
|
| Q |
101 |
agttaagcagattatgtgtctccttcgtgtgaaagtgaataatcctccatttctgggacaaaattcattggcaccccattatgatactgttgcaacacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2446321 |
agttaagcagattatgtgtctccttcgtgtgaatgtgaatgttcctccatttctgggacaaaattcattggcaccccattatgatactgttgcatcacca |
2446222 |
T |
|
| Q |
201 |
aa |
202 |
Q |
| |
|
|| |
|
|
| T |
2446221 |
aa |
2446220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 143 - 202
Target Start/End: Complemental strand, 2451046 - 2450987
Alignment:
| Q |
143 |
tcctccatttctgggacaaaattcattggcaccccattatgatactgttgcaacaccaaa |
202 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
2451046 |
tcctccatttctgggacaaagtttattggcaccccattgtgatactgttgcatcaccaaa |
2450987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 143 - 202
Target Start/End: Complemental strand, 2462056 - 2461997
Alignment:
| Q |
143 |
tcctccatttctgggacaaaattcattggcaccccattatgatactgttgcaacaccaaa |
202 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2462056 |
tcctccatttctgggacaaaatttattggcaccccattgggatactgttgcatcaccaaa |
2461997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 2451201 - 2451142
Alignment:
| Q |
1 |
tcaaataaactttcttatttatgtagaatcgggtccaatgcagattagaaatcttattcc |
60 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||||||| |||||| |||||||| |
|
|
| T |
2451201 |
tcaaataaactttcttatttatgtcgaattgggtacaatgcaggttagaacacttattcc |
2451142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 2462211 - 2462146
Alignment:
| Q |
1 |
tcaaataaactttcttatttatgtagaatcgggtccaatgcagattagaaatcttattcccatccc |
66 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| |||||||| ||||| |||||||||||||| |
|
|
| T |
2462211 |
tcaaataaactttcttatttatgtcaaattgggtgcaatgcaggttagagcacttattcccatccc |
2462146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University