View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8613_high_13 (Length: 274)
Name: NF8613_high_13
Description: NF8613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8613_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 159 - 266
Target Start/End: Complemental strand, 47478025 - 47477918
Alignment:
| Q |
159 |
tgaactaattcctcatgtctcacttggaacccaaggctttcaggtatcatcacttcactcacttgtacacttacacttacatatacaattgtcatttata |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47478025 |
tgaactaattcctcatgtctcacttggaacccaaggctttcaggtatcatcacttcactcacttgtacacttacacttacatatacaaatgtcatttata |
47477926 |
T |
 |
| Q |
259 |
ttcttctc |
266 |
Q |
| |
|
|||||||| |
|
|
| T |
47477925 |
ttcttctc |
47477918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 59 - 126
Target Start/End: Complemental strand, 47478119 - 47478052
Alignment:
| Q |
59 |
cgcatgcgtatatatcactgcaaaatgcaaattggaactgaagcaattactattgaacaaccaaaatg |
126 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47478119 |
cgcattcgtatatatcactgcaaaatgcaaattggaactgaagcaattactattgaacaaccaaaatg |
47478052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 47487069 - 47487029
Alignment:
| Q |
163 |
ctaattcctcatgtctcacttggaacccaaggctttcaggt |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47487069 |
ctaattcctcatgttacacttggaacccaaggctttcaggt |
47487029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University