View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8614_high_3 (Length: 264)

Name: NF8614_high_3
Description: NF8614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8614_high_3
NF8614_high_3
[»] chr4 (2 HSPs)
chr4 (44-134)||(39591704-39591791)
chr4 (1-30)||(39591643-39591672)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 44 - 134
Target Start/End: Original strand, 39591704 - 39591791
Alignment:
44 gaagattacgtggcagtgttgttgaagaaaaatttacaaacnnnnnnnncgatgggaaacagtgttgttattgttgttgtgttgttgttcc 134  Q
    ||||||||||||||||||||| |||||||||||||||||||        ||||||||||||||||||   |||||||||||||||||||||    
39591704 gaagattacgtggcagtgttgatgaagaaaaatttacaaacaaaaaaaacgatgggaaacagtgttg---ttgttgttgtgttgttgttcc 39591791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 39591643 - 39591672
Alignment:
1 caattgattaattaaacatgaaaaatttac 30  Q
    ||||||||||||||||||||||||||||||    
39591643 caattgattaattaaacatgaaaaatttac 39591672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University