View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8614_low_2 (Length: 361)
Name: NF8614_low_2
Description: NF8614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8614_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 11 - 347
Target Start/End: Complemental strand, 34436735 - 34436398
Alignment:
| Q |
11 |
cagagaggtacttgcggcacaattttgacagtgaataacatggcgcgaaacaacagcaggtcacaaaattgagcaacccccgccctgccttcaatcaatg |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34436735 |
cagacaggtacttgcggcacaattttgacagtgaataacatggcgtgaaacaacagcaggtcacaaaattgagcaacccccgccctgccttcaatcaatg |
34436636 |
T |
|
| Q |
111 |
cacagatgtctttaccggtaagggactcggtgcaaatttggtagatgggaaaatcgatcataaattgctagagtaaatcttttccaataaatgttttaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34436635 |
cacagatgtctttaccggtaagggactcggtgcaaatttggtagatgggaaaatcgatcataaattgctagagt-aatcttttccaataaatgttttaag |
34436537 |
T |
|
| Q |
211 |
ttcttccttagctgcttccatcacaacgttaaagtctatcttggtataccttcccctgcgatccacaatttaaatct--tttttagcaacttgcctagac |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34436536 |
ttcttccttagctgcttccatcacaacgttaaagtctatcttggtataccttcccctgcgatccacaatttaaatctcagttttagcaacttgcctagac |
34436437 |
T |
|
| Q |
309 |
gaatgatataaaatatgtagacaaataacatccaataat |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34436436 |
gaatgatataaaatatgtagacaaataacatccaataat |
34436398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University