View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8615_low_5 (Length: 298)
Name: NF8615_low_5
Description: NF8615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8615_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 58 - 211
Target Start/End: Original strand, 40892098 - 40892251
Alignment:
| Q |
58 |
attagagaaagagaacataagagatcctccttgctgcttttctggtttgtgccttggtggtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892098 |
attagagaaagagaacataagagatcctccttgctgcttttctggtttgtgccttggtagtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
40892197 |
T |
 |
| Q |
158 |
ctggtttgtttcattgaagtagctcactaagtggagtgtagtttatcattgcca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892198 |
ctggtttgtttcattgaagtagctcactaagtggagtgtagtttatcattgcca |
40892251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 58 - 211
Target Start/End: Original strand, 44143541 - 44143694
Alignment:
| Q |
58 |
attagagaaagagaacataagagatcctccttgctgcttttctggtttgtgccttggtggtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44143541 |
attagagaaagagaacataagagatcctccgtgctgcttttctggtttgtgccttggtggtttgattgcaacagcagaaggtgtcatgttggtttgatgg |
44143640 |
T |
 |
| Q |
158 |
ctggtttgtttcattgaagtagctcactaagtggagtgtagtttatcattgcca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
44143641 |
ctggtttgtttcattgaagtagctcactaagtggagtatggtttatcattgcca |
44143694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 44140774 - 44140818
Alignment:
| Q |
16 |
acaatattgtgttactagtattatttgttatcatttattcgtatt |
60 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44140774 |
acaaaattgcgttactagtattatttgttatcatttattcgtatt |
44140818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University