View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8617_high_3 (Length: 424)
Name: NF8617_high_3
Description: NF8617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8617_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 1 - 406
Target Start/End: Complemental strand, 13234297 - 13233892
Alignment:
| Q |
1 |
tgattccttgtaaggtattttttggattgtggaacattgttgccatcataactcccatgaaggtgaggaccattagtcttgatagaaaaagctcgggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13234297 |
tgattccttgtaaggtattttttggattgtggaacattgttgccatcataactcccatgaaggtgaggaccattagtcttgatagaaaaagctcgggggt |
13234198 |
T |
 |
| Q |
101 |
tctccgtatgttggtgaagttgcggcgcattaggatccatgtctctgctatgtaggaatttgcaaactttggacctagatgttcttgtgagctattggtt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13234197 |
tctccgtatgtttgtgaagttgcggcgcattaggatccatgtctctcctatgtaggaatttgcaaactttggacctagatgttcttgtgagctatttgtt |
13234098 |
T |
 |
| Q |
201 |
ggtgtaaggtagtcattctcgtcgactacgtagtcgctgctatgtggtgttggtgttgctggaaggatttcacttgagtatgtgtagatgccaggggaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13234097 |
ggtgtaaggtagtcattctcgtcgactacgtagtcactgctatgtggtgttggtgttgctggaaggatttcacttgagtatgtgtagatgccaggggaag |
13233998 |
T |
 |
| Q |
301 |
catggctgcacatcacacaaaaacaatatggtatattacaagtttacatctaattttgattgcatatatcaatttaccattcaatcaataatcatgtatt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13233997 |
catggctgcacatcacacaaaaacaatatggtatattacaagtttacatctaattttgattgcatatatcaatttaccattcaatcaataatcatgtatt |
13233898 |
T |
 |
| Q |
401 |
gtaaac |
406 |
Q |
| |
|
|||||| |
|
|
| T |
13233897 |
gtaaac |
13233892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University