View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8617_low_9 (Length: 267)
Name: NF8617_low_9
Description: NF8617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8617_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 36332066 - 36331818
Alignment:
| Q |
1 |
agccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgattgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36332066 |
agccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgattgctg |
36331967 |
T |
 |
| Q |
101 |
caattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtatgccggtgaatttacgaagaactggcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331966 |
caattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtatgccggtgaatttacgaagaactggcac |
36331867 |
T |
 |
| Q |
201 |
gcatattcggtcgtagacagggatgataatgactaagaaaccaattggg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331866 |
gcatattcggtcgtagacagggatgataatgactaagaaaccaattggg |
36331818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 36324805 - 36324557
Alignment:
| Q |
1 |
agccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgattgctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36324805 |
agccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattatctctagctacattttttcttttcacttctatgattgccg |
36324706 |
T |
 |
| Q |
101 |
caattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtatgccggtgaatttacgaagaactggcac |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| || ||||| ||||||| ||| || | |||||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
36324705 |
cgattgccatcgagatgcaggatagtattaggccaacgcctattcgctgcaagtgagtaatgccggttggtatgccagtgaatttacggagaagtggcac |
36324606 |
T |
 |
| Q |
201 |
gcatattcggtcgtagacagggatgataatgactaagaaaccaattggg |
249 |
Q |
| |
|
||| ||||||||||||| |||||| |||| || ||||||| ||| |||| |
|
|
| T |
36324605 |
gcagattcggtcgtagaaagggattataaagattaagaaaacaactggg |
36324557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University