View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8618_low_5 (Length: 269)
Name: NF8618_low_5
Description: NF8618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8618_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 49 - 255
Target Start/End: Complemental strand, 49089961 - 49089755
Alignment:
| Q |
49 |
atgcacatgccaccgtaatttttaatttcaaccgatcgccattttgtaattttacaatttgcaaactaattacccaactttcttcgctgccatgggcgga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
49089961 |
atgcacatgccaccgtaatttttaatttcaaccgatggccattttgtaattttacaatttgcaaactaatcacccaactttcttcgctgccatgagcgga |
49089862 |
T |
|
| Q |
149 |
aagtttttgcctgtgggtcccatcaaaataaaactttctttccactttgacaatgcaaccatgcaagggaaac-aggtttttcaatgctctttctttcct |
247 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
49089861 |
aagtttttgcccgtggg-cccatcaaaataaaactttctttccactttgacaatgcaaccatgcaagggaaacgacgtttttcaatgctctttctttcct |
49089763 |
T |
|
| Q |
248 |
ctctgctt |
255 |
Q |
| |
|
|| ||||| |
|
|
| T |
49089762 |
ctttgctt |
49089755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 220
Target Start/End: Complemental strand, 26415893 - 26415799
Alignment:
| Q |
126 |
ctttcttcgctgccatgggcggaaagtttttgcctgtgggtcccatcaaaataaaactttctttccactttgacaatgcaaccatgcaagggaaa |
220 |
Q |
| |
|
|||||||||||| || |||||||||||| | ||||| |||||| ||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26415893 |
ctttcttcgctgatttgagcggaaagttttaacacgtgggctccatcataattaaactttctttccactctgacaatgcaaccatgcaagggaaa |
26415799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 49 - 249
Target Start/End: Complemental strand, 45025418 - 45025217
Alignment:
| Q |
49 |
atgcacatgccaccgtaatttttaatttcaaccgatcgccattttgtaattttacaatttgcaaactaattacccaactttcttcgctgccatgggcgga |
148 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||| |
|
|
| T |
45025418 |
atgcacatgccatcgtaatttttaatttcaaccgatggccattttgtaattttacaatttgcaaactaatcacccaactttcttcgctgccatgagtgga |
45025319 |
T |
|
| Q |
149 |
aagtttttgcctgtgggtcccatcaaaataaaactttctttccactttgacaatgcaaccatgcaagggaaac-aggtttttcaatgctctttctttcct |
247 |
Q |
| |
|
||| ||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
45025318 |
aagattttgcccgtgggccccatcaaaataaaactttctttccactttgaccctgcaaccatgcaagggaaacgacatttttgaatgctctttctttcct |
45025219 |
T |
|
| Q |
248 |
ct |
249 |
Q |
| |
|
|| |
|
|
| T |
45025218 |
ct |
45025217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 161 - 220
Target Start/End: Complemental strand, 21271118 - 21271059
Alignment:
| Q |
161 |
gtgggtcccatcaaaataaaactttctttccactttgacaatgcaaccatgcaagggaaa |
220 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21271118 |
gtgggccccatcataattaaactttctttccactgagacaatgcaaccatgcaagggaaa |
21271059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 9415341 - 9415417
Alignment:
| Q |
144 |
gcggaaagtttttgcctgtgggtcccatcaaaataaaactttctttccactttgacaatgcaaccatgcaagggaaa |
220 |
Q |
| |
|
|||||||||||| | ||||| ||||||| ||| |||||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
9415341 |
gcggaaagttttaacacgtgggccccatcataattaaactttctttccactcttacaacgcaaccatgcaagggaaa |
9415417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University