View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8621_high_6 (Length: 363)
Name: NF8621_high_6
Description: NF8621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8621_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 12 - 347
Target Start/End: Original strand, 16435241 - 16435576
Alignment:
| Q |
12 |
catcattttttaatataattctttggtgtgaggagtggtagaaaggggaggttaggtttcatttttatttggcatgctgttttttggactatatgaagta |
111 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16435241 |
catcattttttaatataattctctggtgtgaggagtggtagaaaggggaggttaggtttcattcttatttggcatgctgttttttggactatatgaagta |
16435340 |
T |
|
| Q |
112 |
cccgcaatgattttatctttattggggatctatttatgttgagactttggtgggtaaggtcaaactttacctatgaaagtggttcctaggtaagaacgtt |
211 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16435341 |
cccccaatgattttatttttattggggatctatttatgttgagactttggtgggtaaggtcaaactttacctatgaaagtggttcctaggtaagaacgtt |
16435440 |
T |
|
| Q |
212 |
ggttgcccttgctcctttttcgagtgagagaccaatctcgtcatgtgctagtcttgttagtgttttgtagtagtagtgttagagtcttagtgggttttgt |
311 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16435441 |
ggttgcccttgctcctttttcgagcgagagaccaatctcgtcatgtgctagtcttgttagtgttttgtagtagtagtgttagagtcttagtgggttttgt |
16435540 |
T |
|
| Q |
312 |
gtggtttcgctgttggttctcgaccgatccttttgt |
347 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
16435541 |
ctggtttcgttgttggttctcgaccgatccttttgt |
16435576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University