View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8622_high_21 (Length: 235)
Name: NF8622_high_21
Description: NF8622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8622_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 17380011 - 17379798
Alignment:
| Q |
1 |
ttcagagctcagttcagctagtagatggcctgtttgggcatctttgctgttgtataggcagatattagattctattgaagctaatgactacaataacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17380011 |
ttcagagctcagttcagctagtagatggcctgtttgggcatctttgctgttgtataggcagatattagattctattgaagctaatgactacaataacttc |
17379912 |
T |
 |
| Q |
101 |
actaaacgggcttatgtaggaaaagctaaaaagctcttatcacttcctgttgcttttggaatagcaacgtttggcccacagaagttagccaaaatgacta |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
17379911 |
actaaacgggcttatgtaggaaaggctaaaaagctcttatcacttcctgttgcttttggaatagcaacttttggcccacaaaagttggccaaaatgacta |
17379812 |
T |
 |
| Q |
201 |
caagatgaacatga |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17379811 |
caagatgaacatga |
17379798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 39517117 - 39516993
Alignment:
| Q |
1 |
ttcagagctcagttcagctagtagatggcctgtttgggcatctttgctgttgtataggcagatattagattctattgaagctaatgactacaataacttc |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | ||| |||| ||||||||||||||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
39517117 |
ttcagagctcagttctgctagtagatggcctgtatgggcagcattgttgttatataggcagatattagattctattgaagccaatgattataataacttc |
39517018 |
T |
 |
| Q |
101 |
actaaacgggcttatgtaggaaaag |
125 |
Q |
| |
|
|||||| |||||||||| ||||||| |
|
|
| T |
39517017 |
actaaaagggcttatgtcggaaaag |
39516993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University