View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8622_high_22 (Length: 233)
Name: NF8622_high_22
Description: NF8622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8622_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 53618496 - 53618279
Alignment:
| Q |
1 |
ccacaattcatagtcatcccaatgcaaaaaagggtacctttctttcttcttgtttttgctgaattgatacacaccgcatatggtgatcaaacacattaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53618496 |
ccacaattcatagtcatcccaatgcaaaaaagggtacctttctttcttcttgtttttgctgaattgatacacaccgcatatggtgatcaaacacactaat |
53618397 |
T |
|
| Q |
101 |
gtgaaattatgtgatcaccatataaacgttagaaacgatatcctaataattccagcatttgtggtgatacgtagtacagccaaataattttgactaatta |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53618396 |
gtgaaattatgtgat-accatataaacgttagaaacgatatcctaataattccagcatttgtggtgatacttagtacagccaaataattttgactaatta |
53618298 |
T |
|
| Q |
201 |
tccaacttccagtcaaaac |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53618297 |
tccaacttccagtcaaaac |
53618279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University