View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8622_low_12 (Length: 382)
Name: NF8622_low_12
Description: NF8622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8622_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 9 - 366
Target Start/End: Complemental strand, 28161794 - 28161439
Alignment:
| Q |
9 |
gagatggacatcaaagctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctatagaaaaaagaagtggcacttggt |
108 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161794 |
gagaaggacaccaaagctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctatagaaaaaagaagtggcacttggt |
28161695 |
T |
 |
| Q |
109 |
tcctccattgtgtcgggattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161694 |
tcctccattgtgtcgggattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttc |
28161595 |
T |
 |
| Q |
209 |
cgtgagccatgccggggttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtccagtgaagaggctttcctccgct |
308 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161594 |
catgagccatgccggggttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtccagtgaagaggctttcctccgct |
28161495 |
T |
 |
| Q |
309 |
agatgttttggttcctgcatattatagtcattaattttgtcaaagcaatgtcaaaatg |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161494 |
agatgttttggttcctgc--attatagtcattaattttgtcaaagcaatgtcaaaatg |
28161439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University