View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8622_low_19 (Length: 265)
Name: NF8622_low_19
Description: NF8622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8622_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 254
Target Start/End: Original strand, 46752098 - 46752332
Alignment:
| Q |
20 |
ttaagcagcatctagtcacgacttcaatttttaaccgaaatcattattataacttaattaatctgcacatttaactatggagactaatctcatgaaataa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46752098 |
ttaagcagcatctagtcacgacttcaatttttaaccgaaatgattattataacttaattaatctgcacatttaactatggagactaatctcatgaaacaa |
46752197 |
T |
 |
| Q |
120 |
gatttctttagaaaaagacatctaaaatccaaagtcagtggtggagagccttgctaaacctatggcccccatgcttgccttatttgaacaaattttcagt |
219 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752198 |
gatttctttataacaagacatctaaaatccaaagtcagtggtggagagccttgctaaacctatggcccccatgcttgccttatttgaacaaattttcagt |
46752297 |
T |
 |
| Q |
220 |
gctccaataataatgaacactcgatactcctctct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752298 |
gctccaataataatgaacactcgatactcctctct |
46752332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University