View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8622_low_20 (Length: 255)
Name: NF8622_low_20
Description: NF8622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8622_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 31421173 - 31421327
Alignment:
| Q |
1 |
ttcttcttcttctattggttcttttccttgatggtttcaatgttttcgatccggtcccgttttagtttgtcccaatctgttccagatctgactgctacgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | |
|
|
| T |
31421173 |
ttcttcttcttctattggttcttttccttgagggtttcaatgttttcgatccggtcccgttttagtttgtcccgatctgttccagatttgactgctacac |
31421272 |
T |
 |
| Q |
101 |
cgtacacggctgtctgctacgccggagacctctctctgttgctattcacgttttt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31421273 |
cgtacacggctgtctgctacgccggagacctctctctgttgctattcacgttttt |
31421327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University