View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8622_low_22 (Length: 240)
Name: NF8622_low_22
Description: NF8622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8622_low_22 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 4134726 - 4134949
Alignment:
| Q |
17 |
aagttgtacttctatcacctaatccattttcattaaaatgatggctagttatgtgctatgaatatcgttaaaattatgatttctgctagtcatttctatt |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4134726 |
aagttgtacttcaatcacctaatccattttcattagaatgatggctagttatgtgctatgaatatcgttaaaattatgatttctgctagtcatttctatt |
4134825 |
T |
 |
| Q |
117 |
cattttaggacaagttatgtttctgcaataggtttttagaaacaccgtgattgatccagaaggatgtcctcaacattgatgtacatagcttctttcaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4134826 |
cattttaggacaagttatgtttctgcaataggtttttagaaacaccgtgattgatccagaaggatgtcctcaacattgatgtacatagcttctttcaaca |
4134925 |
T |
 |
| Q |
217 |
gatgtctcattcgtgctggtaaat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4134926 |
gatgtctcattcgtgctggtaaat |
4134949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 44152422 - 44152494
Alignment:
| Q |
31 |
tcacctaatccattttcattaaaatgatggctagttatgtgctatgaatatcgttaaaattatgatttctgct |
103 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||||||||||||| ||| ||||| |||||| |||| |
|
|
| T |
44152422 |
tcacctaatccattttctttagaatgatggctagtttagtgctatgaatattgtttaaattctgatttgtgct |
44152494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University