View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8622_low_27 (Length: 226)
Name: NF8622_low_27
Description: NF8622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8622_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 37835347 - 37835551
Alignment:
| Q |
11 |
attatacttgccttctttccctggttatttggagcaaaagagagaagaaaaagctatgaagtttaatttcggggaatacaatatttatactttcttattt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37835347 |
attacacttgccttctttccctggttatttggagcaaaagagagaagaaaaagctatgaagtttaattttggggaatacaatatttatactttcttattt |
37835446 |
T |
 |
| Q |
111 |
catatttgat-------acaaaagtatgtcattagttcattcctccttaaattacctcctcttccagataatggactaaaacaatgtgtgagagtttcct |
203 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37835447 |
catatttgattgttacaataaaagtatgtcattagttcattcctccttaaattacctcctcttccagataatggactaaaacaatgtgtgagagtttcct |
37835546 |
T |
 |
| Q |
204 |
ataac |
208 |
Q |
| |
|
||||| |
|
|
| T |
37835547 |
ataac |
37835551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University