View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8624_low_1 (Length: 369)
Name: NF8624_low_1
Description: NF8624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8624_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 10 - 153
Target Start/End: Complemental strand, 23523000 - 23522857
Alignment:
| Q |
10 |
cagagaaagtagtagcatgtaccatagttgattgaaggtgttgtcgttttgcgtgttgacgttctcttttgtgtgcgttttgatgaccacctaaggcttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523000 |
cagagaaagtagtagcatgtaccatagttgattgaaggtgttgtcgttttgcgtgttgacgttctcttttgtgtgcgttttgatgaccacctaaggcttg |
23522901 |
T |
 |
| Q |
110 |
tgaagtaggaaagtttctacaacagtaatgacattcaaatcttc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522900 |
tgaagtaggaaagtttctacaacagtaatgacattcaaatcttc |
23522857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 23522770 - 23522654
Alignment:
| Q |
237 |
tccggagactcagaggactcgtcttcggtggcgccaccaccgaattcgataccgaagaggcggatgcctttctctttgttagtaggaggaggacggatga |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522770 |
tccggagactcagaggactcgtcttcggtggcgccaccaccgaattcgataccgaagaggcggatgcctttctctttgttagtaggaggaggacggatga |
23522671 |
T |
 |
| Q |
337 |
agggaagttgagagaat |
353 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
23522670 |
agggaagttgagagaat |
23522654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University