View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8625_high_10 (Length: 211)
Name: NF8625_high_10
Description: NF8625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8625_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 39905166 - 39904991
Alignment:
| Q |
19 |
cgttgcataacactagctaagatagcccatgtatctatcataagttagagctatttattcattagtagcttggtgggcgtacgttgtttcaacaattcct |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| || |
|
|
| T |
39905166 |
cgttgcataacactagctaagctagcccatgtatctatcatgagttagagctatttattcattagaagcatggtgggcgtacgttgtttcaacaatttct |
39905067 |
T |
 |
| Q |
119 |
ggtgcaaaagcagcggtgacggacaccccgacaatcaccaccaatgaaaccttcacccctgcataccgatccacag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39905066 |
ggtgcaaaagcagcggtgacggacaccccgacaatcaccaccaatgaaaccttcacccctgcataccgatccacag |
39904991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 106 - 194
Target Start/End: Complemental strand, 39901242 - 39901154
Alignment:
| Q |
106 |
ttcaacaattcctggtgcaaaagcagcggtgacggacaccccgacaatcaccaccaatgaaaccttcacccctgcataccgatccacag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| || ||||||||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
39901242 |
ttcaacaattcctggtgcaaaagcagcggcgacggaagcctcgacaatcaccaccagtgaaaccttcacctctgcataccgatgcacag |
39901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University