View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8625_low_6 (Length: 342)
Name: NF8625_low_6
Description: NF8625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8625_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 73 - 321
Target Start/End: Complemental strand, 7387904 - 7387656
Alignment:
| Q |
73 |
ctttagggaatggatatgtggttttagctacacatggccacaaattggatctgcctctgacaacagtcattgtatcatatttaagtggacaaaatgatcc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7387904 |
ctttagggaatggatatgtggttttagccacacatggccacaaattggatctgcctctgacaacagtcattgtatcatatttaagtggacaaaatgatcc |
7387805 |
T |
|
| Q |
173 |
ttctgttgtatgatatattgattcagactatgcttgtgatatgctaaaggatctatttgttgaaaatcatttgatcaattcatagtggcaatgtctgaaa |
272 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7387804 |
ttctgttgtaggatatattgattcagactatgcttgtgatatgctaaaggatctatttgttgaaaatcatttggtcaattcatagtggcaatgtctgaaa |
7387705 |
T |
|
| Q |
273 |
ttgaagagtagtacatagtagtaattaaggttgtcaaagagatcttaca |
321 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
7387704 |
ttgaagagtagtacatagcagtagttaaggttgtcaaagaggtcttaca |
7387656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University