View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8625_low_7 (Length: 315)
Name: NF8625_low_7
Description: NF8625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8625_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 1956794 - 1956853
Alignment:
| Q |
1 |
ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaa |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1956794 |
ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatctaggtaaaaa |
1956853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 1941703 - 1941761
Alignment:
| Q |
1 |
ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaa |
59 |
Q |
| |
|
||||||||||||||||||||| ||||| | || |||||| |||||||||| |||||||| |
|
|
| T |
1941703 |
ggttttgcaattagtgagacagcttttttaatcttccttctcatggcatctaggtaaaa |
1941761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 297
Target Start/End: Original strand, 36774869 - 36774903
Alignment:
| Q |
263 |
taatttttaaatcccataagaacaagtgtgatatg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774869 |
taatttttaaatcccataagaacaagtgtgatatg |
36774903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University