View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8625_low_7 (Length: 315)

Name: NF8625_low_7
Description: NF8625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8625_low_7
NF8625_low_7
[»] chr6 (2 HSPs)
chr6 (1-60)||(1956794-1956853)
chr6 (1-59)||(1941703-1941761)
[»] chr8 (1 HSPs)
chr8 (263-297)||(36774869-36774903)


Alignment Details
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 1956794 - 1956853
Alignment:
1 ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaa 60  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
1956794 ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatctaggtaaaaa 1956853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 1941703 - 1941761
Alignment:
1 ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaa 59  Q
    ||||||||||||||||||||| ||||| | || |||||| |||||||||| ||||||||    
1941703 ggttttgcaattagtgagacagcttttttaatcttccttctcatggcatctaggtaaaa 1941761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 297
Target Start/End: Original strand, 36774869 - 36774903
Alignment:
263 taatttttaaatcccataagaacaagtgtgatatg 297  Q
    |||||||||||||||||||||||||||||||||||    
36774869 taatttttaaatcccataagaacaagtgtgatatg 36774903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University