View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8626_high_10 (Length: 251)
Name: NF8626_high_10
Description: NF8626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8626_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 5 - 132
Target Start/End: Complemental strand, 44342277 - 44342149
Alignment:
| Q |
5 |
ggagtagcagagatataacaacatgggtggccgccaagttgtagggtgagtagtact-acttattcaatttctcactattcacttcatttttcacgtttc |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342277 |
ggagttgcagagatataacaacatgggtggccgccaagttgttgggtgagtagtacttactttttcaatttctcactattcacttcatttttcacgtttc |
44342178 |
T |
 |
| Q |
104 |
aaaaatatttggtaggtgacatgcctcat |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44342177 |
aaaaatatttggtaggtgacatgcctcat |
44342149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 44342141 - 44342107
Alignment:
| Q |
151 |
attaatatttaatcatgtctttagctcgattcact |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342141 |
attaatatttaatcatgtctttagctcgattcact |
44342107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University