View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8626_high_14 (Length: 241)
Name: NF8626_high_14
Description: NF8626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8626_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 39 - 220
Target Start/End: Original strand, 9338782 - 9338963
Alignment:
| Q |
39 |
tatgctccagaacctcaactcatttcggtaactcaattatctgtttattactatgtctcctatctcccctttgcaagcatgatgtatttacaaaagagaa |
138 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9338782 |
tatgctccgaaacctcaactcatttcggtaacacaattatctgtttattactatgtctcctatctcccctttgcaagcatgatgtatttacaaaagagaa |
9338881 |
T |
|
| Q |
139 |
ggaaatctacttctataatgggctaggcttcttacattgttgtgcttcacatgtaaattaacctgatttaaaggaaaagagt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9338882 |
ggaaatctacttctataatgggctaggcttcttacattgttgtgcttcacatgtaaacgaacctgatttaaaggaaaagagt |
9338963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 216
Target Start/End: Original strand, 54083069 - 54083130
Alignment:
| Q |
155 |
aatgggctaggcttcttacattgttgtgcttcacatgtaaattaacctgatttaaaggaaaa |
216 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
54083069 |
aatgggctaggcttcttgcatagctgtgcttcacatgtaaaccaacctgatattaaggaaaa |
54083130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University