View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8626_high_19 (Length: 223)
Name: NF8626_high_19
Description: NF8626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8626_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 36790849 - 36791024
Alignment:
| Q |
17 |
atagacaaacactcatgtttcagctcctggatctacttggattatcgtataataagaggagctgtcttaggaaatgattgaacttaaaagacagctgcca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36790849 |
atagacaaacactcatgtttcagctcctggatctgcttagattatcgtataataagaggagccgtcttaggaaatgattgaacttaaaagacagatgcca |
36790948 |
T |
 |
| Q |
117 |
cctctgtgagggagtcacttgtcgatcttgcggtgcactcactcccgctacgagaatgaaaagaaaccacttgtta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36790949 |
cctctgtgagggagtcacttgtcgatcttgcggtgcactcactcccgctgcgagaatgaaaagaaaccacttgtta |
36791024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 122
Target Start/End: Original strand, 5033402 - 5033471
Alignment:
| Q |
52 |
cttggattatcgtataataagaggagctgtcttaggaaatgattgaacttaaaagacagctgccacctctg |
122 |
Q |
| |
|
||||||||||||||||||||| | || ||||||| |||||| |||| ||||||||||| || |||||||| |
|
|
| T |
5033402 |
cttggattatcgtataataag-gaagacgtcttagaaaatgactgaatttaaaagacagatgtcacctctg |
5033471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University