View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8626_high_21 (Length: 210)
Name: NF8626_high_21
Description: NF8626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8626_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 29696143 - 29696316
Alignment:
| Q |
1 |
actcatattgtttggggattcttgcattttgacgttatgtcaaaaattgt------------ttgtttattttccatgaatatcatcccatatcccaatt |
88 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29696143 |
actcatattggttgtggattcttgcattttgatgttatgttaaaaattgttgtgatgtttgtttgtttattttccacgaatatcatcccatatcccaatt |
29696242 |
T |
|
| Q |
89 |
atggatgctttctaatcacttatttctattcagggtaggctataaatggattacgcaattccttgctcttggat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29696243 |
atggatgctttctaatcacttatttctattcagggtaggctataaatggattacgcaattccttgctcttggat |
29696316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 192
Target Start/End: Complemental strand, 29696352 - 29696316
Alignment:
| Q |
156 |
cttggataaagcctggtaaaagcagtagagcataaca |
192 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29696352 |
cttgaataaagcctggtaaaagcagtagagcataaca |
29696316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University