View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8626_low_14 (Length: 251)

Name: NF8626_low_14
Description: NF8626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8626_low_14
NF8626_low_14
[»] chr8 (2 HSPs)
chr8 (5-132)||(44342149-44342277)
chr8 (151-185)||(44342107-44342141)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 5 - 132
Target Start/End: Complemental strand, 44342277 - 44342149
Alignment:
5 ggagtagcagagatataacaacatgggtggccgccaagttgtagggtgagtagtact-acttattcaatttctcactattcacttcatttttcacgtttc 103  Q
    ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||    
44342277 ggagttgcagagatataacaacatgggtggccgccaagttgttgggtgagtagtacttactttttcaatttctcactattcacttcatttttcacgtttc 44342178  T
104 aaaaatatttggtaggtgacatgcctcat 132  Q
    |||||||||||||||||||||||||||||    
44342177 aaaaatatttggtaggtgacatgcctcat 44342149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 44342141 - 44342107
Alignment:
151 attaatatttaatcatgtctttagctcgattcact 185  Q
    |||||||||||||||||||||||||||||||||||    
44342141 attaatatttaatcatgtctttagctcgattcact 44342107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University