View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8626_low_24 (Length: 228)
Name: NF8626_low_24
Description: NF8626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8626_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 36 - 196
Target Start/End: Complemental strand, 42552956 - 42552796
Alignment:
| Q |
36 |
atgcacatcatgtatgatgagagacaaaacgaagaaaaagaaaatgttataaataatagtaatgttattatttattaaaaatggccaacattgcttgacc |
135 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42552956 |
atgcacatcatatctgatgagagacaaaacgaagaaaaagaaaatgttataaataatagtaatgttattatttattaaaaatggccaacattgcttgacc |
42552857 |
T |
|
| Q |
136 |
nnnnnnnnnnnnnnnnntgaccaacattgtttatataaatttggtaacattactcacctcc |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42552856 |
aaaaaataaataaaaaatgaccaacattgtttttataaatttggtaacattactcacctcc |
42552796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 42553013 - 42552974
Alignment:
| Q |
1 |
tagataagaaagataaatctggcacttttcaattcatgca |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42553013 |
tagataagaaagataaatctggcacttttcaattcatgca |
42552974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University