View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8627_high_3 (Length: 237)
Name: NF8627_high_3
Description: NF8627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8627_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 1743712 - 1743491
Alignment:
| Q |
1 |
tccttcatcaaatttcacaatctgggttggacctagatttgattaatctttccaaccaaagaacacttcctgttgatggattgcgagaactcggtacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1743712 |
tccttcatcaaatttcacaatctgggttggaccttgatttgattaatctttccaaccaaagaacacttcctgttgatggattgcgagaactcggtacaaa |
1743613 |
T |
|
| Q |
101 |
gatgataaacttgagggttttgatttgctcaaacattggctctcttcgcgatagccatctggtagtgatagcttattgtttcccatttcttgaagagctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
1743612 |
gatgataaacttgagggttttgatttgctcgaacgttggatctcttcgcgatagccatctggtagtgatagcttattgctttccatttcttgaagagctt |
1743513 |
T |
|
| Q |
201 |
gatattagctttcctttggatt |
222 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
1743512 |
gacattagctttcctttggatt |
1743491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 3 - 222
Target Start/End: Original strand, 2006672 - 2006891
Alignment:
| Q |
3 |
cttcatcaaatttcacaatctgggttggacctagatttgattaatctttccaaccaaagaacacttcctgttgatggattgcgagaactcggtacaaaga |
102 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||| |||||||||||||||| |||||| |||||||||||||||||||||| |||||| |||||| |
|
|
| T |
2006672 |
cttcatcaagtttcacaatctgggctggaccttgatttcgttaatctttccaaccagagaacagttcctgttgatggattgcgagagctcggttcaaaga |
2006771 |
T |
|
| Q |
103 |
tgataaacttgagggttttgatttgctcaaacattggctctcttcgcgatagccatctggtagtgatagcttattgtttcccatttcttgaagagcttga |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2006772 |
tgataaacctgagggttttgatttgctcaaacattggctctctttgcgatagccatctggtagtgatagcttattgctttccatttcttgaagagcttga |
2006871 |
T |
|
| Q |
203 |
tattagctttcctttggatt |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2006872 |
cattagctttcctttggatt |
2006891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 90
Target Start/End: Complemental strand, 1749055 - 1749015
Alignment:
| Q |
50 |
ttccaaccaaagaacacttcctgttgatggattgcgagaac |
90 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1749055 |
ttccaaccagagaacacttccccttgatggattgcgagaac |
1749015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 41
Target Start/End: Original strand, 44577565 - 44577603
Alignment:
| Q |
3 |
cttcatcaaatttcacaatctgggttggacctagatttg |
41 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
44577565 |
cttcatcaaatttcacaaactgggttggaccttgatttg |
44577603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University