View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8627_high_5 (Length: 220)
Name: NF8627_high_5
Description: NF8627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8627_high_5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 23192841 - 23192622
Alignment:
| Q |
1 |
gtcttctaaatatttgagccatgaccccttagtcccagtatacataaaattgtcaacaaactagtccttttatatcaccaatttattccttttcctggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23192841 |
gtcttctaaatatttgagccatgaccccttagtcccagtatacataaaattgtcaacaaactagtccttttatatcaccaatttattccttttcctggag |
23192742 |
T |
|
| Q |
101 |
gaatttggtgaccattgtatagtttttagcaactaattcgtttacagaaggctcaatctggcaacaccctaatcttcagatccacttttcatcctcttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23192741 |
gaatttggtgaccattgtatagtttttagcaactaattcgtttacagaaggctcaatctggcaacaccctaatcttcagatccacttttcatcctcttct |
23192642 |
T |
|
| Q |
201 |
acatactcatattttataat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
23192641 |
acatactcatattttataat |
23192622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University