View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8628_high_8 (Length: 229)
Name: NF8628_high_8
Description: NF8628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8628_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 202
Target Start/End: Original strand, 35739099 - 35739285
Alignment:
| Q |
13 |
tttggtggtcttatgttaaggttcatgtgagagatccaatttttaaaggatgttgttgttctcgttcttacttttagagcaattgttgtgaggttaattg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35739099 |
tttggtggtcttatgttaaggttcatgtgagagatccaatttttaaaggatgttgttgt---cgttcttacttttagagcaattgttgtgagattaattg |
35739195 |
T |
|
| Q |
113 |
ggttttttgcataattttaataacattgtattgagtttagcataaaaacaatctaaatgaaaaacatccacacaaattgtttcacaataa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35739196 |
ggttttttgcataattttaataacattgtattgagttttgcataaaggaaatctaaatgaaaaatatccacacaaattgtttcacaataa |
35739285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 133 - 211
Target Start/End: Original strand, 35747093 - 35747171
Alignment:
| Q |
133 |
taacattgtattgagtttagcataaaaacaatctaaatgaaaaacatccacacaaattgtttcacaataaggcgatact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35747093 |
taacattgtattgagtttagcataaaaaaaatctaaatgaaaaacatccacacaaattgtttcacaataaggcgatact |
35747171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University