View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8628_low_13 (Length: 240)
Name: NF8628_low_13
Description: NF8628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8628_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 53349118 - 53349338
Alignment:
| Q |
19 |
atactgtcaaaaacatactacagtggtaattaagttaaactctaactttgacacgtgaaatcggctatatggatcaaaccataccataaaatttagatat |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||| || ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53349118 |
ataccgtcaaaaacatactacagtggtaatcaaattaaagtctaacttggacacgtgaaatcggctatatggatcaaaccataccataaaatttagatat |
53349217 |
T |
 |
| Q |
119 |
gcattttatgtatggatagacagtatacttatgtgtctcttttgattatttatcatcaatttttcttttggaagtgggatacaaaattagtgttgacaat |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53349218 |
gcattt-atgtatggatagacagtatacttatgtgtctcttttgattatttatcatcaatttttcttctggaagtgggatacaaaattagtgttgacaat |
53349316 |
T |
 |
| Q |
219 |
agattagcatttggagcaaatc |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53349317 |
agattagcatttggagcaaatc |
53349338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University