View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8628_low_15 (Length: 214)
Name: NF8628_low_15
Description: NF8628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8628_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 44 - 209
Target Start/End: Original strand, 46667317 - 46667483
Alignment:
| Q |
44 |
tttctacatcttttttcctatcaatgttaatattattaattgttaatttattcttattatgtt-gtgtgtggaaatcaagtcattgatcttcttattact |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
46667317 |
tttctacatcttttttcctatcaatgttaatattattaattgttaatttattcttattatgttagagtgtggaaatcaagtcattgatcttcttattact |
46667416 |
T |
|
| Q |
143 |
tcgctctttaacgccacattaagttccttatcaaatgtgactttggtattgtgatgcagtttcattt |
209 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46667417 |
tcactctttaacgccacattaagttccttatcaaatgtgactttggtattgtgatgcagtttcattt |
46667483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 51
Target Start/End: Original strand, 43960703 - 43960751
Alignment:
| Q |
3 |
tatcatttagatttcgcagatttataaattttataaatgtctttctaca |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
43960703 |
tatcatttagatttcgcagattaataaattttataaatgtctttttaca |
43960751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University