View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8629_high_8 (Length: 422)
Name: NF8629_high_8
Description: NF8629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8629_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 84 - 341
Target Start/End: Complemental strand, 30635848 - 30635591
Alignment:
| Q |
84 |
ctgccttagtaatttgatgaacaccattattatttttataactttctttctctnnnnnnnnctaggaaactttgatctgaatagcaattaatcaagatca |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30635848 |
ctgccttagtaatttgatgaacaccattattatttttataactttctttctctaaaaaaaactaggaaactttgatctgaacagcaattaatcaagatca |
30635749 |
T |
 |
| Q |
184 |
tactagactcaggagaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatgcaatgaatca |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30635748 |
tactagactcaggagaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatacaatgaatca |
30635649 |
T |
 |
| Q |
284 |
gaggctagaatataaaaatcttatattatttactttagtcaacaattcccttgctctc |
341 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30635648 |
gaggctagaatatagaaatcttatattatttactttagtcaacaattcccttgctctc |
30635591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University