View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8629_low_21 (Length: 236)
Name: NF8629_low_21
Description: NF8629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8629_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 37343567 - 37343348
Alignment:
| Q |
1 |
acatcctcatcttcaaagtcttatgtttaattcttcccgataccaattcgggttggatagtttaccaacacacagaatttgagaattcacccattgagct |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37343567 |
acatcctcatcttcaaagtctcatgtttaattcttcccgataccaattcgggttggatagtttaccaacaca--gaatttgagaattcacccattgagct |
37343470 |
T |
 |
| Q |
101 |
tcttacgtactactaactgttggcgaataagacttgatccaatatcacatggaagaagctcgttatgaatgcaacaaatttaagttagtaggctttattc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37343469 |
tcttacgtactacttactgttggcgaataagacttgatccaatatcacatggaagaagctcgttatgaatgcaacaaatttaagttagtaggctttattc |
37343370 |
T |
 |
| Q |
201 |
ccagtaacatcaatcaacattc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37343369 |
ccagtaacatcaatcaacattc |
37343348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 98
Target Start/End: Original strand, 37343227 - 37343255
Alignment:
| Q |
70 |
acacagaatttgagaattcacccattgag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37343227 |
acacagaatttgagaattcacccattgag |
37343255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University