View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8629_low_23 (Length: 225)
Name: NF8629_low_23
Description: NF8629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8629_low_23 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 46974219 - 46973994
Alignment:
| Q |
1 |
cgattgcaatttagagagtgaaagttgatgcaaaaatcaaa-gtaaacaacgatggacaaccatacaaagagcttcatgtgaattcaagcaatcccactc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46974219 |
cgattgcaatttagagagtgaaagttgatgcaaaaatcaaaagtaaacaactatggacaaccatacaaagagcttcatgtgaattcaagcaatcccactc |
46974120 |
T |
|
| Q |
100 |
aaacttaagatggaatcactagtctaaatcacacagttgtaagttgtaactataaacaagtgttgtggaagttcctaaatggcactgtcctattcaacca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46974119 |
aaacttaagatggaatcactagtctaaatcacacagttgtaagttgtaactataaacaagtgttgtggaagttcctaaatggcactgtcctattcaacca |
46974020 |
T |
|
| Q |
200 |
atgttactgttttggtaaagtatcgt |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46974019 |
atgttactgttttggtaaagtatcgt |
46973994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University