View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8630_high_8 (Length: 233)
Name: NF8630_high_8
Description: NF8630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8630_high_8 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 44146768 - 44146985
Alignment:
| Q |
1 |
tgctatctacacttgatttccagcttcaacaatgacatgagactccctgattccacatttgtttctcttccccaattacactaatttatacaccaaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44146768 |
tgctatctacacttgatttccagcttcaacaatgacatgagactccctgattccacatttgtttctcttccccaattacactaatttatacaccaaaaac |
44146867 |
T |
 |
| Q |
101 |
gatccagtatcaacataactacaggctaatgccttcccagctgaggttggcagagaaaatgctagctgagtgcgttcgagctccaagcccgtgcagaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44146868 |
gatccagtatcaacataactacaggctaatgccttcccagctgaggttggcagagaaaatgctagctgagtgcgttcgagctccaagcccgtgcagaaac |
44146967 |
T |
 |
| Q |
201 |
ttttcctgcctcaaattt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44146968 |
ttttcctgcctcaaattt |
44146985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 84 - 218
Target Start/End: Original strand, 7074 - 7208
Alignment:
| Q |
84 |
atttatacaccaaaaacgatccagtatcaacataactacaggctaatgccttcccagctgaggttggcagagaaaatgctagctgagtgcgttcgagctc |
183 |
Q |
| |
|
||||||||||||| || ||||||||| | ||| |||| ||||||||||||||| |||||||||| ||| |||||||||| || |||| ||||| |
|
|
| T |
7074 |
atttatacaccaagaatgatccagtaccggtgtaattacatgctaatgccttcccaactgaggttggtgcagagaatgctagctcagcacgttgaagctc |
7173 |
T |
 |
| Q |
184 |
caagcccgtgcagaaacttttcctgcctcaaattt |
218 |
Q |
| |
|
|||| | |||||||||||||||||||| ||||||| |
|
|
| T |
7174 |
caagtcggtgcagaaacttttcctgccacaaattt |
7208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University