View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8630_low_12 (Length: 238)
Name: NF8630_low_12
Description: NF8630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8630_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 14166578 - 14166356
Alignment:
| Q |
1 |
ctttaccatgtccacaaaatattgttactacaatgattt-aactttacattttctgatcatattgtaggtggtgcgagatgcaatcaagaaggttggaac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166578 |
ctttaccatgtccacaaaatattgttactacaatgatttgaactttacattttctgatcaaatcgtaggtggtgcgagatgcaatcaagaaggttggaac |
14166479 |
T |
|
| Q |
100 |
cgatgaggatgcgctcacccgtgtgattgtgagcagagctcagcatgacctaaaagtcatctcagatgtttactacaaaagaaacagtgttcttcttgag |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166478 |
tgatgaggatgcgctgacccgtgtgattgtgagcagagctcagcatgacctaaaagtcatctcagatgtttactacaaaagaaacagtgttcttcttgag |
14166379 |
T |
|
| Q |
200 |
catgttgtggccaaggaaacttc |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14166378 |
catgttgtggccaaggaaacttc |
14166356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 92 - 129
Target Start/End: Original strand, 5189555 - 5189592
Alignment:
| Q |
92 |
gttggaaccgatgaggatgcgctcacccgtgtgattgt |
129 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5189555 |
gttggaaccgatgaggatgcactcacccgtgtgattgt |
5189592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University