View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8630_low_3 (Length: 367)
Name: NF8630_low_3
Description: NF8630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8630_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 15 - 298
Target Start/End: Original strand, 42451001 - 42451284
Alignment:
| Q |
15 |
tctattggcttattggcaatttccaaggatttatcaaatttggatggatttaagagaattgacatactgggtgcaaccattgatcttgtgttttcacttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42451001 |
tctattggcttattggcaatttccaaggatttatcaaatttggatggatttaagagaattgacatactgggtgcaaccattgatcttgtgttttcacttt |
42451100 |
T |
 |
| Q |
115 |
tggatgatacgatatgtctcacggagtaggataccacatgtttgttttgataaatttgttgttccatcaatgatcaattctattcggtgaagacaattgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42451101 |
tggatgatacgatatgtctcacggagtaggataccacatgtttgttttgataaatttgttgttccatcaatgatcaattctattcggtgaagacaattgt |
42451200 |
T |
 |
| Q |
215 |
tgtggttctttgcttgcttatggtttatccaaaactgtgaaggtttaaaaattggaatatgggtgaatgaaaccagcataactt |
298 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42451201 |
tgtggttctttgcttacttatggtttatccaaaactgtgaaggtttaaaaattggaatatgggtgaatgaaaccagcatgactt |
42451284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 27857872 - 27857807
Alignment:
| Q |
24 |
ttattggcaatttccaaggatttatcaaatttggatggatttaagagaattgacatactgggtgca |
89 |
Q |
| |
|
|||||||||||||||||| | || ||| ||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
27857872 |
ttattggcaatttccaagaacttgtcagatttggatggatttaagagaattgacaaacttggtgca |
27857807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University