View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8630_low_5 (Length: 336)
Name: NF8630_low_5
Description: NF8630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8630_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 327
Target Start/End: Original strand, 28189804 - 28190095
Alignment:
| Q |
18 |
attatattatatgtccccctattttttgacataatataaaacaacaaaatcattaattacaaaataacttaggacaaaaatatcttcatagtgttggaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28189804 |
attatattatatgtccccctattttttgacataatataaaacaacaaaataattaattacaaaataacttaggacaaaaatatcttcatagtgttggaga |
28189903 |
T |
|
| Q |
118 |
aagataatcttatcttatcttactctagtgctctacactcttggtcacaagggtaatttaggaattccatcaagtacaaacagaacacgacaaaaacctc |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28189904 |
aagataatcttatctta-cttactctagtgctctacactcttggtcacaagggtaatttaggaattccatcaagtacaaacagaacacgacaaaaacctc |
28190002 |
T |
|
| Q |
218 |
aatattaacgaccctggattttccatcaaaaagaccaatatacccttagggtttaacttggccatgtcaagacctcgtccaagtcaaactcaccaaactc |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28190003 |
aatattaacgac-----------------aaagaccaatatacccttagggtttaacttggccatgtcaagaactcgtccaagtcaaactcaccaaactc |
28190085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University