View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8630_low_7 (Length: 264)
Name: NF8630_low_7
Description: NF8630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8630_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 14166750 - 14167006
Alignment:
| Q |
1 |
tacggatggtggtatacaatgccttctgaaattcatcagatccttcatccaacagcttctgtaaagattaaacggacacaaatttaaataacgagttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
14166750 |
tacggatggtggtatacaatgccttctgaaattcatcagatccttcatccaacagcttctgtaaagattaaacggacacaaatttaaataacgaatcata |
14166849 |
T |
|
| Q |
101 |
atatcataannnnnnnaatatcgtaatctttttattatataccttagtgatggaagtaccatgagtctctctgtagcggttgaatgtcgcaatcagctgg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166850 |
atatcataatttttttaatatcgtaatctttttattatataccttagtgatggaagtaccatgagtctctctgtagcggttgaatgtcgcaatcagctgg |
14166949 |
T |
|
| Q |
201 |
gttttgctccttgtagtcaagatcctaatggcttcttcatgacttcctttcttctct |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14166950 |
gttttgctccttgtagtcaagatccttatggcttcttcatggcttcctttcttctct |
14167006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 168 - 257
Target Start/End: Original strand, 14173880 - 14173969
Alignment:
| Q |
168 |
tctctgtagcggttgaatgtcgcaatcagctgggttttgctccttgtagtcaagatcctaatggcttcttcatgacttcctttcttctct |
257 |
Q |
| |
|
||||||||||||||||| || || | ||||| || |||||||||||||| | ||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
14173880 |
tctctgtagcggttgaaagttgccaaaagctgagtcttgctccttgtagtaaggattctaatggcttcttcatgatttccttttttctct |
14173969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University