View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_high_15 (Length: 242)
Name: NF8631_high_15
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_high_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 52914093 - 52914316
Alignment:
| Q |
19 |
atggaaactatgccaggtggaagagttatgagtgacatgattttacttcctaacggcgacgttttgttgattaatggtgcagctgtggggtctgctggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52914093 |
atggaaactatgccaggtggaagagttatgagtgacatgattttacttcctaacggcgacgttttgttgattaatggtgcagctgtggggtctgctggtt |
52914192 |
T |
|
| Q |
119 |
gggaatcgggtcgtaatccggttttgaatccgtttctttataaaccaaatagtttagttgggtcaagatttcagttacaaaaaccttctgatattccacg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52914193 |
gggaatcgggtcgtaatccggttttgaatccgtttctttataaaccaaatagtttagttgggtcaagatttcagttacaaaaaccttctgatattccacg |
52914292 |
T |
|
| Q |
219 |
aatgtaccattcaactgctgtttt |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52914293 |
aatgtaccattcaactgctgtttt |
52914316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University