View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_high_19 (Length: 216)
Name: NF8631_high_19
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 11 - 206
Target Start/End: Complemental strand, 43976003 - 43975795
Alignment:
| Q |
11 |
gcaggttaccgcagcgtagatatgaaaggcaacttactagtagagagatataaaattccaacaagacatgccacaaaaattgaatgtttgttccataata |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43976003 |
gcagcttaccgcagcgtagatatgaaaggcaacttactagtagagagatataaaatttcaacaagacatgccacaaaaattgaatgtgtgttccataata |
43975904 |
T |
|
| Q |
111 |
aaaattcagttaaaattacggtttttat------------tttagtctatgaatacctttttgttaggattgcaaatt-aaaaaaccgttacttttcgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43975903 |
aaaattcagttaaaattacggtttttattttattttttattttagtctatgaatacctttttgttaggattgcaaattaaaaaaaccgttacttttcgtt |
43975804 |
T |
|
| Q |
198 |
catgatgtc |
206 |
Q |
| |
|
||||||||| |
|
|
| T |
43975803 |
catgatgtc |
43975795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University