View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_13 (Length: 423)
Name: NF8631_low_13
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 17 - 412
Target Start/End: Complemental strand, 29319369 - 29318974
Alignment:
| Q |
17 |
agatctaccttcaaacacaaaattggatagaaaaagcaaagccatttatagcagttttgtttttgcaatttggatatgcaattatggatgttctatcaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319369 |
agatctaccttcaaacacaaaattggatagaaaaagcaaagccatttatagcagttttgtttttgcaatttggatatgcaattatggatgttctatcaaa |
29319270 |
T |
|
| Q |
117 |
ggctgcattgaacagaggaatgagcaactatgtatttgttgtgtaccgccatgccgttgcattcattgttataaccccttttgcactctattttgatagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319269 |
ggctgcattgaacagaggaatgagcaactatgtatttgttgtgtaccgccatgccgttgcattcattgttataaccccttttgcactctattttgatagg |
29319170 |
T |
|
| Q |
217 |
tataatcctctctccatctatatgtttgtgttttatttggtttggaattcactacttggttcttctttgcaaagtcttaaatttagggagagaaaaatct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319169 |
tataatcctctctccatctatatgtttgtgttttatttggtttggaattcactacttggttcttctttgcaaagtcttaaatttagggagagaaaaatct |
29319070 |
T |
|
| Q |
317 |
aaatttgtcaacaatgacccctacaacaaggaccaggtttccctagctgtattattttcctgcagtttcacgctataatagattgtggccgttcat |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
29319069 |
aaatttgtcaacaatgacccctacaacaaggaccaggtttccctagctgtattattttcctgcagtttcacgttgtaatagattatggccgttcat |
29318974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University