View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_19 (Length: 332)
Name: NF8631_low_19
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 308
Target Start/End: Complemental strand, 30097882 - 30097596
Alignment:
| Q |
18 |
tatattggaaaatgctaatcaaattaggtactaattgctagagtgtataagtaattaatgctaaacacttgaggtgtttgtttattagtagtaagagttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
30097882 |
tatattggaaaatgctaatcaaattaggtactaattgctagagtgtataagtaattaatgctaaacacttgaggtgttagt---ttagtagtaagagttt |
30097786 |
T |
 |
| Q |
118 |
aactgacattgtctcaagatgttgttgagttccaaacctctcgagacagtcgtaaaataatcatcagtgccgcttattaataaaaaattcaccctttatc |
217 |
Q |
| |
|
|||| ||||||| | ||| ||||||||| || ||||||||||| |||||||||||||||| |||| || ||||||||||||| ||||||||||||| |
|
|
| T |
30097785 |
aactcacattgtttagaga---tgttgagtttgaatcctctcgagacggtcgtaaaataatcattagtgtcgtttattaataaaaatttcaccctttatc |
30097689 |
T |
 |
| Q |
218 |
t-gcgttgttttaaaggcttacattgtcatattggaacctcctctaccgttgttgccaag-ttttggcttccattgtcatatctatcatgagg |
308 |
Q |
| |
|
| |||||| ||||||| |||||||||||||||||||||||||||| |||||||| |||| ||||| ||||||||||||| |||||||||||| |
|
|
| T |
30097688 |
taccgttgtattaaagggttacattgtcatattggaacctcctctatcgttgttgtcaagtttttgacttccattgtcatgtctatcatgagg |
30097596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 268 - 324
Target Start/End: Complemental strand, 3118906 - 3118850
Alignment:
| Q |
268 |
gttgccaagttttggcttccattgtcatatctatcatgaggctatgaagttcttctc |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3118906 |
gttgccaagttttggcttccattgtcatatctatcatgaggctatgaagttcttctc |
3118850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University