View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_29 (Length: 260)
Name: NF8631_low_29
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 25 - 251
Target Start/End: Complemental strand, 4886937 - 4886711
Alignment:
| Q |
25 |
gctttgctagtatggctagtagacaaacacctttgctttagtagtcaaattaaagcacttcactaacctacaatccatccattaggtacatataaagtgt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4886937 |
gctttgctagtatggctagtagacaaacatctttgctttagtagtcaaattaaagcacttcactaacctaaaatccatccattaggtacatataaagtgt |
4886838 |
T |
 |
| Q |
125 |
gaaatccatcaaacttcactttccaatgaaaaccacaacccacatgatcatgcttgggggaattgaaagatcacaattcacaaacacactctcaaaagaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4886837 |
gaaatccatcaaacttcactttccaatgaaaaccacaacccacatgatcatgcttgggggaattgaaagatcacaattcacaaacactctctcaaaagaa |
4886738 |
T |
 |
| Q |
225 |
gatctcctctcctcatttcatctcact |
251 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
4886737 |
gatctcctcttctcatttcatctcact |
4886711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University