View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_32 (Length: 244)
Name: NF8631_low_32
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 118 - 233
Target Start/End: Complemental strand, 12651165 - 12651050
Alignment:
| Q |
118 |
ctctgacaaaatgaatcagcttttattaccaattaattgcttttattctggtacaaagtcaacatctactccattaaagcctatttttcatattttaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12651165 |
ctctgacaaaatgaatcagcttttattaccaattaattgcttttattctggtacaaagtcaacatctactccattaaagcctatttttcatattttaatt |
12651066 |
T |
|
| Q |
218 |
cttcccatgattctct |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12651065 |
tttcccatgattctct |
12651050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 12651265 - 12651202
Alignment:
| Q |
18 |
aaaagcactgaagtgagatatattgctctgcttgttgggttgagtcaaaattgcaaactgttga |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12651265 |
aaaagcactgaagtgagatatattgctctgcttgttgggttgagtcaaaattgcaaactgttga |
12651202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 12646132 - 12646075
Alignment:
| Q |
18 |
aaaagcactgaagtgagatatattgctctgcttgttgggttgagtcaaaattgcaaac |
75 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
12646132 |
aaaagcacagaagtgagatatattacactgcttgttgggttgagtcaaagttgcaaac |
12646075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University