View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_33 (Length: 244)
Name: NF8631_low_33
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 52432809 - 52433017
Alignment:
| Q |
18 |
ataactgcatatcatatgaccgtaataaataaagggatacatacatacatatatatggtgaccccgcgtgtgcnnnnnnnacccatattgaaagtgactc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52432809 |
ataactgcatatcatatgaccgtaataaataaagggatacatacata--------tggtgaccccgcgtgtgctttt---acccatattgaaagtgactc |
52432897 |
T |
 |
| Q |
118 |
gtgaatgtatgtgaggttgtattgtagttctacttcaacgcttgctagctagttattagttactatatacaccaccagaccaggcataacccctcttctt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52432898 |
gtgaatgtatgtgaggttgtattttagttctacttcaacgtttgctagctagttagtagttactatatacaccaccagaccaggcataacccctcttctt |
52432997 |
T |
 |
| Q |
218 |
tttcttatttcaaccaccaa |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52432998 |
tttcttatttcaaccaccaa |
52433017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University