View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_39 (Length: 227)
Name: NF8631_low_39
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 115 - 214
Target Start/End: Complemental strand, 39292804 - 39292705
Alignment:
| Q |
115 |
caaaataagatagaattgagatttgcttaagcgacaagtatgagatgtttatggaagtaaaggctttgtggacgcaaggtagattatattttaagtagat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39292804 |
caaaataagatagaattgagatttgcttaagcgacaagtatgagatgtttatggaagtaaaggctttgtggacgcaaggtagattatattttaagtagat |
39292705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University