View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_42 (Length: 223)
Name: NF8631_low_42
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 38108491 - 38108299
Alignment:
| Q |
1 |
tcctctgttttaccataagataatttctacatttatttgaaattttcttcttcgtatttataaagtgttgtggatcaagttttcaattgttataatatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38108491 |
tcctctgttttaccataagataatttctacatttatttgaaattttctttttcgtatttataaagtgttgtggatcaagttttcaattgttatattatgg |
38108392 |
T |
 |
| Q |
101 |
taggagctgctcggtattannnnnnnnnnnnnngataagctgcaattgtgtaatttcaactccttaatttaattagtttaatatcctgtgaaa |
193 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38108391 |
taggagctgatcggtattatttttttcttttttgataagctgcaattgtgtaatttcaactccttaatttaattagtttaatatcctgtgaaa |
38108299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University