View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8631_low_43 (Length: 222)
Name: NF8631_low_43
Description: NF8631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8631_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 41223892 - 41224095
Alignment:
| Q |
1 |
gtcaatgttgagtgtagtgactgtattgctaattatatatactacatgttagagcatttggctgaaaatattgatgactcagtgaagaccacactagaga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
41223892 |
gtcaatgttgaatgtagtgactgtattgctaattatatatactacatgttagagcatttggctgaaaatattgatgactcggtgaagaccgcactagaga |
41223991 |
T |
|
| Q |
101 |
tggtcaatgaagttgcaatgaagcctgtgaggaataacatagcacacttgctaaatttatggatttgattggttagtgcaatagtgcaacttttgctaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41223992 |
tggtcaatgaagttgcaatgaagcctgtgaggaataacatagcacacttgctaaatttatggatttgattggttagtgcaatagtgcaacttttgctact |
41224091 |
T |
|
| Q |
201 |
ttct |
204 |
Q |
| |
|
|||| |
|
|
| T |
41224092 |
ttct |
41224095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University